We use cookies to distinguish you from other users and to provide you with a better experience on our websites. Close this message to accept cookies or find out how to manage your cookie settings. Learn more about our Privacy Notice... [opens in a new tab]

Conformational Dynamics of RNA G4C2 and C2G4 Repeat Expansions causing ALS/FTD using NMR and Molecular Dynamics Studies

09 January 2023, Version 1
This content is a preprint and has not undergone peer review at the time of posting.

Abstract

RNA G4C2 and C4G2 repeat expansions in the chromosome 9 open reading frame 72 gene (C9orf72) are the most common cause of genetically defined amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD), referred to as c9ALS/FTD. The gene is bidirectionally transcribed, producing G4C2 repeats, r(G4C2)exp, in the sense and C4G2 repeats, r(C4G2)exp, in the antisense strands. Akin to other repeat expansions, those operating in c9ALS/FTD are highly structured, which contributes to their gain-of-function mechanism. Structural studies have revealed that r(G4C2)exp predominantly folds into a hairpin, which has periodic arrays of 1×1 G/G internal loops and a G-quadruplex. Recent studies on small molecule probes revealed that r(G4C2)exp adopts a new hairpin structure in which the 1×1 G/G internal loops transform into 2×2 GG/GG internal loops. We first evaluated the performance of four different RNA force fields with conventional MD simulations and showed that only the one having revised χ and α/γ torsional parameters maintained the helicity of a model r(G4C2)2. We then used this force field to study the conformational dynamics adopted by 2×2 GG/GG loops in a model system of r(UCUGGGGCCAGA)2 using temperature replica exchange molecular dynamics (T-REMD) simulations covering over 1.7 ms cumulative simulation time. We further characterized the structure and underlying dynamics of these internal loops using traditional 2D NMR techniques, illustrating the possibility of adopting different configurations around the glycosidic bond, i.e., anti vs. syn, using a hairpin model, r(CCAGGGCAAGGAAACUUGGGCUGG). Results display that closing base pairs play an important role in the structure and dynamics of these systems with the most preferred configuration being in syn-anti/anti-syn and anti-syn/anti-syn. Analogous studies on r(C4G2) repeats, which fold into an array of 2×2 CC/CC internal loops, revealed that this structure is not as dynamic as 2×2 GG/GG internal loops, where the residues adopt all anti configurations, although the dynamics of the loop residues is affected by the closing base pairs. Collectively, these studies emphasize the unique sensitivity of r(G4C2)exp to small changes in stacking interactions, which is not observed in r(C4G2)exp, providing important considerations for further principles in structure-based drug design.

Keywords

RNA
Molecular Dynamics
Genetic Disease

Comments

Comments are not moderated before they are posted, but they can be removed by the site moderators if they are found to be in contravention of our Commenting Policy [opens in a new tab] - please read this policy before you post. Comments should be used for scholarly discussion of the content in question. You can find more information about how to use the commenting feature here [opens in a new tab] .
This site is protected by reCAPTCHA and the Google Privacy Policy [opens in a new tab] and Terms of Service [opens in a new tab] apply.